- In taxonomy,
Vulcanisaeta is a
genus of the Thermoproteaceae.
Vulcanisaeta is an anaerobic, heterotrophic,
hyperthermophilic archaeon that
grows optimally...
-
genome sequence of "
Vulcanisaeta moutnovskia"
strain 768-28, a
novel member of the
hyperthermophilic crenarchaeal genus Vulcanisaeta".
Journal of Bacteriology...
-
Thermoproteales Family:
Thermoproteaceae Zillig &
Stetter 1982 emend.
Burggraf et al. 1997
Genera Caldivirga Pyrobaculum Thermocladium Thermoproteus Vulcanisaeta...
- by
feeding on the life
essence of
other creatures. Vulcanibacillus,
Vulcanisaeta and Vulcanithermus: Vulc****, the
Roman god of fire. List of Archaea...
- Pyrobaculum, Pyrococcus, Staphylothermus, Thermococcus,
Thermodiscus and
Vulcanisaeta". The
Journal of
General and
Applied Microbiology. 49 (5): 287–293. doi:10...
- Thermoproteaceae,
including species in the
genera Pyrobaculum,
Caldivirga and
Vulcanisaeta. All
retain a
conventional catalytic domain, but lack a recognizable...
-
Caldivirga Itoh et al. 1999
Thermocladium Itoh,
Suzuki &
Nakase 1998
Vulcanisaeta Itoh,
Suzuki &
Nakase 2002
Family "Marsarchaeaceae"
Family Desulfurococcaceae...
- GCCCCGAAAC--- 3' 3' ---GAAGT CATACGGGGCTTTG--- 5' I-Vdi141I H1 3E54
Vulcanisaeta distributa IC-141 A 5'
CCTGACTCTCTTAAGGTAGCCAAA 3' GGACTGAGAGAATTCCATCGGTTT...