- genetics, a
subclade is a
subgroup of a haplogroup.
Although human mitochondrial DNA (mtDNA) and Y
chromosome DNA (Y-DNA)
haplogroups and
subclades are named...
- Look up
subclade in Wiktionary, the free dictionary.
Subclade may be
Subclade, any
taxonomic clade which is
subordinate to
hierarchically higher clades...
-
South Asia. Some
subclades of
haplogroup U have a more
specific geographic range.
Subclades are
labelled U1–U9;
Haplogroup K is a
subclade of U8. Van Oven...
- (R-M479).
Males carrying R-M173 in
modern po****tions
appear to
comprise two
subclades: R1a and R1b,
which are
found mainly in po****tions
native to Eurasia...
- with all
known subclades as of June 2015. It
contains the E-V1515
clade defined by
Trombetta et al. 2015, and all the E1b1b
subclades distributed below...
- Asia, and
North Africa. The most
commonly occurring subclades are G1* (M285) and many
subclades of G2 (G-P287), especially: G2a (P15), G2a1 (G-FGC7535...
-
tccaatctcaattcatgcctc In Y
chromosome phylogenetics,
subclades are the
branches of a haplogroup.
These subclades are also
defined by single-nucleotide polymorphisms...
-
known subclades,
which are
haplogroup E-P2 and
haplogroup E-P75.
Haplogroup E-P2 is a
subclade of
haplogroup E-P177.
Haplogroup E-P75 is a
subclade of haplogroup...
-
Uyghurs also had it. In Y-chromosome phylogenetics,
subclades are the
branches of haplogroups.
These subclades are also
defined by
single nucleotide polymorphisms...
- SNP M19
which defines subclade Q-M19. M19 has been
detected in 59% of
Amazonian Ticuna men and in 10% of
Wayuu men.
Subclades Q-M19 and Q-M199 appear...
