Definition of Ecotropic. Meaning of Ecotropic. Synonyms of Ecotropic

Here you will find one or more explanations in English for the word Ecotropic. Also in the bottom left of the page several parts of wikipedia pages related to the word Ecotropic and, of course, Ecotropic synonyms and on the right images related to the word Ecotropic.

Definition of Ecotropic

No result for Ecotropic. Showing similar results...

Meaning of Ecotropic from wikipedia

- Ecotropism or ecotropic (from eco – hearth and tropic – to turn towards) refers to the philosophy that for human culture to be healthy, it must exist...
- Cbl (named after Casitas B-lineage Lymphoma) is a mammalian gene family. CBL gene, a part of the Cbl family, encodes the protein CBL which is an E3 ubiquitin-protein...
- infect a wide range of hosts and tissues are said to be amphotropic. Ecotropic pathogens, on the other hand, are only capable of infecting a narrow range...
- their envelope region. The ecotropic MLVs (from Gr.eco, "Home") are capable of infecting mouse cells in culture. Non-ecotropic MLVs may be xenotropic (from...
- (1p36) EPS15 (1p32) ESPN: espin (autosomal recessive deafness 36) EVI5: ecotropic viral integration site 5 EXO5: encoding protein Exonuclease 5 EXTL1: exostosin...
- EVI5L (Ecotropic Viral Integration Site 5-Like) is a protein that in humans is encoded by the EVI5L gene. EVI5L is a member of the Ras superfamily of...
- MDS1 and EVI1 complex locus protein EVI1 (MECOM) also known as ecotropic virus integration site 1 protein homolog (EVI-1) or positive regulatory domain...
- Goff SP, Arriagada G (August 2016). "Dynein Regulators Are Important for Ecotropic Murine Leukemia Virus Infection". Journal of Virology. 90 (15): 6896–6905...
- receptor-induced calcium mobilization. This protein interacts with Cas-Br-M (murine) ecotropic retroviral transforming sequence c. Two transcript variants encoding distinct...
- TACTGCTTTTGGTGTCATATCTAAG + Sine oculis homeobox homolog 4 CTTTTGGTGTCATAT + Ecotropic viral integration site 1 encoded factor, amino-terminal zinc finger domain...