Definition of CCAAA. Meaning of CCAAA. Synonyms of CCAAA

Here you will find one or more explanations in English for the word CCAAA. Also in the bottom left of the page several parts of wikipedia pages related to the word CCAAA and, of course, CCAAA synonyms and on the right images related to the word CCAAA.

Definition of CCAAA

No result for CCAAA. Showing similar results...

Meaning of CCAAA from wikipedia

- The Coordinating Council of Audiovisual Archives ****ociations (CCAAA) is an umbrella group of international private organizations working on audiovisual...
- conference within the California Community College Athletic ****ociation (CCAAA). The conference formed in July 2007 as the Big 7 Conference when seven...
- weak promoter and the CAAT box has a gene expression attenuating mutation (CCAAA instead of CCAAT), but has a higher enzyme activity of endopolygalacturonase...
- regulation. CTCCTACTCAGACTGTTACTCTGGTGACACAACCTGTGGTTACTAAGGAAACTGCCATCT CCAAA[CTAGAAATGCCATCTTCCTTGATGTTGGAG]GTACCTGCTCTGGCAGATTTCAACC...
- programme. Co-ordinating Council of Audiovisual Archives ****ociations (CCAAA) International Council on Archives (ICA) International Council on Monuments...
- situations that could affect cultural heritage. They were joined in 2005 by the CCAAA (Co-ordinating Council of Audiovisual Archives ****ociations), who later...
- member of the Coordinating Council of Audiovisual Archives ****ociations (CCAAA), an international umbrella group concerned with audiovisual preservation...
- member of the Coordinating Council of Audiovisual Archives ****ociations (CCAAA). Training of archive personnel takes place at FIAF Summer Schools and Technical...
- governing bodies of archives, libraries, museums and do****entary heritage—the CCAAA, ICOM, ICCROM, IFLA and Memory of the World regional committees—many collecting...
- campaign by the Coordinating Council of Audiovisual Archives ****ociations (CCAAA). Past projects in countries such as East Timor, Madagascar, Zimbabwe, Romania...