Definition of Aactcttgataaaccgtgctg. Meaning of Aactcttgataaaccgtgctg. Synonyms of Aactcttgataaaccgtgctg

Here you will find one or more explanations in English for the word Aactcttgataaaccgtgctg. Also in the bottom left of the page several parts of wikipedia pages related to the word Aactcttgataaaccgtgctg and, of course, Aactcttgataaaccgtgctg synonyms and on the right images related to the word Aactcttgataaaccgtgctg.

Definition of Aactcttgataaaccgtgctg

No result for Aactcttgataaaccgtgctg. Showing similar results...

Meaning of Aactcttgataaaccgtgctg from wikipedia

- attccgattcctagtcacttgg M241 G to A 54 366 aactcttgataaaccgtgctg tccaatctcaattcatgcctc M242 C to T 180 366 aactcttgataaaccgtgctg tccaatctcaattcatgcctc M253 C to...
- Position (base pair): 180 Total size (base pairs): 366 Forward 5′→ 3′: aactcttgataaaccgtgctg Reverse 5′→ 3′: tccaatctcaattcatgcctc In Y chromosome phylogenetics...